| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.233143 |
| Chromosome: | chromosome 8 |
| Location: | 4553017 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g382800 | CDPK13 | (1 of 1) PF00036//PF07714//PF13499 - EF hand (EF-hand_1) // Protein tyrosine kinase (Pkinase_Tyr) // EF-hand domain pair (EF-hand_7); Calcium/calmodulin-dependent protein kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACCTGCACCACGCTGCCCTGCAGCGGCA |
| Internal bar code: | TAGGTACGCGCCGCGGGGAGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 452 |
| LEAP-Seq percent confirming: | 91.4894 |
| LEAP-Seq n confirming: | 172 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACTTCTGACGAGACCCGAG |
| Suggested primer 2: | GTTCGCATCGCCTACTTCTC |