| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.233233 |
| Chromosome: | chromosome 8 |
| Location: | 4853917 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g384650 | ELI7,ELIP7 | Early light-induced LHC-like protein; (1 of 6) PTHR14154//PTHR14154:SF5 - UPF0041 BRAIN PROTEIN 44-RELATED // EARLY LIGHT-INDUCED PROTEIN 1, CHLOROPLASTIC-RELATED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGGCAAGATATGGTCCCACAGTCGAGCA |
| Internal bar code: | GTAATGGCTACCGAAAGGGCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 178 |
| LEAP-Seq percent confirming: | 87.0748 |
| LEAP-Seq n confirming: | 128 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGAGAGAGGAGAGAGCGA |
| Suggested primer 2: | CTCCATCTACACAGCCAGCA |