Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.233273 |
Chromosome: | chromosome 14 |
Location: | 1459766 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g617950 | CAM18 | Calmodulin-like protein; (1 of 5) PTHR23050//PTHR23050:SF90 - CALCIUM BINDING PROTEIN // CENTRIN-3 | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGCGGTCCATGGTGGCCTTGTTGAACAA |
Internal bar code: | ATGTATAGGGATCTAGCGAATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 181 |
LEAP-Seq percent confirming: | 99.6974 |
LEAP-Seq n confirming: | 1318 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCTGGTGCTAATTTGGGTGT |
Suggested primer 2: | TCGCCCTCAAAAGCCTACTA |