| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.233307 |
| Chromosome: | chromosome 9 |
| Location: | 3794538 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g391541 | (1 of 1) K17616 - CTD small phosphatase-like protein 2 [EC:3.1.3.-] (CTDSPL2) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGAGGTAGTTGCCGTCCACCACCACGCAG |
| Internal bar code: | TCGCCGAGGGGGCGTTCCCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 607 |
| LEAP-Seq percent confirming: | 84.2878 |
| LEAP-Seq n confirming: | 2870 |
| LEAP-Seq n nonconfirming: | 535 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATGCCGTTGTCCACCTAGT |
| Suggested primer 2: | CTGTGTTCACGATGTACGGG |