| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.233315 |
| Chromosome: | chromosome 3 |
| Location: | 4703756 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g177750 | MAE10 | (1 of 5) PTHR11206:SF94 - DNA-DAMAGE-INDUCIBLE PROTEIN F; related to EDS5, enhanced disease susceptibility gene | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGGCCTGGCCTCTCCTTCCGCAACTGGA |
| Internal bar code: | GCACAGTCTGAGGGGGCGACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 453 |
| LEAP-Seq percent confirming: | 98.0365 |
| LEAP-Seq n confirming: | 699 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGCATAGGTATTGGGTCT |
| Suggested primer 2: | ATCGCCTATCCAGCATGAAC |