Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.233416 |
Chromosome: | chromosome 10 |
Location: | 2457674 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g436000 | POC2 | Proteome of centriole protein 2; (1 of 2) PTHR10877//PTHR10877:SF135 - POLYCYSTIN-RELATED // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCTTCATTGTTACGGTTGGCTTGTAGGTT |
Internal bar code: | GACAGGGGTGGACGTTTTGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 103 |
LEAP-Seq percent confirming: | 99.7321 |
LEAP-Seq n confirming: | 4839 |
LEAP-Seq n nonconfirming: | 13 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCTGCAACAGATCCAGCAAC |
Suggested primer 2: | AACACACGGTTCGTGTTCAA |