| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.233436 |
| Chromosome: | chromosome 7 |
| Location: | 5955775 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g354500 | HSF2 | (1 of 2) K09419 - heat shock transcription factor, other eukaryote (HSFF); Heat shock transcription factor 2 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTTCAGGTGCGGAGTGCGCTGCTTGACG |
| Internal bar code: | GCTCACCGCGACTGATCCTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 592 |
| LEAP-Seq percent confirming: | 98.8487 |
| LEAP-Seq n confirming: | 2490 |
| LEAP-Seq n nonconfirming: | 29 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGACGCATCCCTACCTTACC |
| Suggested primer 2: | CTGGCCAGCTAGGCTATGTC |