Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.233474 |
Chromosome: | chromosome 16 |
Location: | 4670520 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g687300 | CPLD61 | Conserved in the Plant Lineage and Diatoms; (1 of 3) PF13599 - Pentapeptide repeats (9 copies) (Pentapeptide_4) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCATGGGCATGCAAGTTTAACTGAAACGA |
Internal bar code: | CACTTAGGTCAGCGGGAAGATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 581 |
LEAP-Seq percent confirming: | 97.2112 |
LEAP-Seq n confirming: | 1220 |
LEAP-Seq n nonconfirming: | 35 |
LEAP-Seq n unique pos: | 31 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACTGCAACTGCTGCTGCTT |
Suggested primer 2: | TGCTTCATGGCATAATTGGA |