Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.233520 |
Chromosome: | chromosome 17 |
Location: | 41107 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g696400 | CLPS1 | Clp protease adaptor protein; (1 of 1) K06891 - ATP-dependent Clp protease adaptor protein ClpS (clpS) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTTATGCACGAACACATGTGTGCAATCCT |
Internal bar code: | GAGTCGTCCGAGACGGTACGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 615 |
LEAP-Seq percent confirming: | 99.2855 |
LEAP-Seq n confirming: | 2918 |
LEAP-Seq n nonconfirming: | 21 |
LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CCGTATCAGCACCGTATCCT |
Suggested primer 2: | CGTTTTCCACATGTGTCCTG |