| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.233520 |
| Chromosome: | chromosome 17 |
| Location: | 41215 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g696400 | CLPS1 | Clp protease adaptor protein; (1 of 1) K06891 - ATP-dependent Clp protease adaptor protein ClpS (clpS) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAACGGACTCACGTCGACCATTGAGCCGG |
| Internal bar code: | TGTGCGGGCCACCTGCTGTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 600 |
| LEAP-Seq percent confirming: | 99.5949 |
| LEAP-Seq n confirming: | 10573 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGTATCAGCACCGTATCCT |
| Suggested primer 2: | CGTTTTCCACATGTGTCCTG |