| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.233546 |
| Chromosome: | chromosome 16 |
| Location: | 7127278 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g680454 | (1 of 8) PF13417 - Glutathione S-transferase, N-terminal domain (GST_N_3) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTGCACGGCAACCAGTCAGGCTCCCACAC |
| Internal bar code: | CGGGCGATTTTGGCTTTAGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 696 |
| LEAP-Seq percent confirming: | 99.1476 |
| LEAP-Seq n confirming: | 2210 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 20 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGATTGGGAGTGTGTGTGC |
| Suggested primer 2: | ATAGTTGCTTTGTGTGGGGC |