| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.233556 |
| Chromosome: | chromosome 9 |
| Location: | 7615636 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g414800 | CPY | Serine carboxypeptidase; (1 of 1) K16297 - serine carboxypeptidase-like clade II [EC:3.4.16.-] (SCPL-II) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTGCCTTAGCAAGGCCACGTGCCCATGC |
| Internal bar code: | AACCTATCATGCCGCCGGACGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 651 |
| LEAP-Seq percent confirming: | 99.2453 |
| LEAP-Seq n confirming: | 1315 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGATAGTGTGCATGACCGC |
| Suggested primer 2: | CTTCTGATGCATGTCACGCT |