Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.233556 |
Chromosome: | chromosome 9 |
Location: | 7615643 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g414800 | CPY | Serine carboxypeptidase; (1 of 1) K16297 - serine carboxypeptidase-like clade II [EC:3.4.16.-] (SCPL-II) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGCATGGGTTCAGAGGTGTTCTGTGGACT |
Internal bar code: | GTTTGCCCTGGCTAGCATAGCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 510 |
LEAP-Seq percent confirming: | 99.1914 |
LEAP-Seq n confirming: | 12880 |
LEAP-Seq n nonconfirming: | 105 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGATAGTGTGCATGACCGC |
Suggested primer 2: | CTTCTGATGCATGTCACGCT |