Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.233653 |
Chromosome: | chromosome 3 |
Location: | 5927429 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g190150 | CGL1 | (1 of 2) PF11833 - Protein of unknown function (DUF3353) (DUF3353); Conserved in the Green Lineage | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCCTCAACCCCAGAACTTCGGCTCGCC |
Internal bar code: | CAGCGCATATGCTGCTTGACAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 594 |
LEAP-Seq percent confirming: | 99.7676 |
LEAP-Seq n confirming: | 1717 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTGCCAACCAGTATTCCT |
Suggested primer 2: | ACTGCGATGCATACAAGCAC |