| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.233752 |
| Chromosome: | chromosome 12 |
| Location: | 9499653 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g541352 | LIP1 | (1 of 1) PTHR11005//PTHR11005:SF17 - LYSOSOMAL ACID LIPASE-RELATED // AB-HYDROLASE ASSOCIATED LIPASE REGION CONTAINING PROTEIN; Putative triacylglycerol lipase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGTGGGCTTTACTATACGCCCTGCCGT |
| Internal bar code: | TAACAGATGCCCCAAACGAAGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 909 |
| LEAP-Seq percent confirming: | 98.9583 |
| LEAP-Seq n confirming: | 760 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGTATGGGGCGTAACTCTC |
| Suggested primer 2: | GTCAAGCCCAGCCAAAGTAG |