| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.233778 |
| Chromosome: | chromosome 14 |
| Location: | 1215416 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616100 | FKB11,FKB53 | (1 of 1) K14826 - FK506-binding nuclear protein [EC:5.2.1.8] (FPR3_4); Peptidyl-prolyl cis-trans isomerase, FKBP-type | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACGGCAGTCCGCCGCAAGTCTTGCCCTGG |
| Internal bar code: | TTGGGGCAACCTGATGCCTCCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 818 |
| LEAP-Seq percent confirming: | 99.2147 |
| LEAP-Seq n confirming: | 379 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAAGGGACTTCGTGCTGAG |
| Suggested primer 2: | GACTGAGTGGTAAGCAGGGC |