| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.233839 |
| Chromosome: | chromosome 8 |
| Location: | 2159440 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g369300 | P4H16,PFH16,PHX1 | Prolyl 4-hydroxylase 16; (1 of 5) PTHR10869//PTHR10869:SF55 - PROLYL 4-HYDROXYLASE ALPHA SUBUNIT // OXOGLUTARATE/IRON-DEPENDENT OXYGENASE | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGAAGATGTTGACAAGTCCTTGTGGAAAG |
| Internal bar code: | CAGTAAGCGAACCAAGCGTAGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 567 |
| LEAP-Seq percent confirming: | 98.8124 |
| LEAP-Seq n confirming: | 416 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCAACCAACCAAGCTCACC |
| Suggested primer 2: | AGCACAGTGACCGCACATAC |