| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.233857 |
| Chromosome: | chromosome 17 |
| Location: | 6118368 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g741450 | CPN60B1,CPN60 beta1 | (1 of 3) K04077 - chaperonin GroEL (groEL, HSPD1); Chaperonin 60B1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAACCCAATGCCCCGGCGGCTTCTGCA |
| Internal bar code: | ATGGTAGCTCGCACGCTCTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 550 |
| LEAP-Seq percent confirming: | 99.4348 |
| LEAP-Seq n confirming: | 7037 |
| LEAP-Seq n nonconfirming: | 40 |
| LEAP-Seq n unique pos: | 8 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGCACAGCAAAGAGATGG |
| Suggested primer 2: | GTGTTTGTGCGGTTGATTTG |