| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.233888 |
| Chromosome: | chromosome 5 |
| Location: | 912906 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g247300 | (1 of 1) PF13432//PF13489 - Tetratricopeptide repeat (TPR_16) // Methyltransferase domain (Methyltransf_23) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCTGCCCCGCGGGCCATGTACGGCAGCA |
| Internal bar code: | TGTGGTCGCCGAGCCCACCCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 685 |
| LEAP-Seq percent confirming: | 95.2961 |
| LEAP-Seq n confirming: | 7820 |
| LEAP-Seq n nonconfirming: | 386 |
| LEAP-Seq n unique pos: | 94 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCACGGGTGTAAATGAAG |
| Suggested primer 2: | GTAGCCGTCCATTTGGAGAA |