| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.233908 |
| Chromosome: | chromosome 1 |
| Location: | 5220086 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g036350 | PMA1 | (1 of 5) K01537 - Ca2+-transporting ATPase (E3.6.3.8); Related to plasma membrane P-type and chloroplast type calcium ATPases | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TATTCAAATGGAGCGCAGCAAACAACGGAC |
| Internal bar code: | CGCCAGGCCATCCTGAGAACGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 576 |
| LEAP-Seq percent confirming: | 99.1146 |
| LEAP-Seq n confirming: | 1903 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 33 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTGGTGATAAGGCCAGTT |
| Suggested primer 2: | ACACACGTACCTGCTTGCTG |