| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.233910 |
| Chromosome: | chromosome 9 |
| Location: | 5134725 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g398882 | DLI1,D1bLIC | Dynein 1b Light Intermediate Chain D1bLIC; (1 of 1) K10417 - dynein light intermediate chain 2, cytosolic (DYNC2LI) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGTGCGGGCATCCCGCATGTAACATCCCG |
| Internal bar code: | GCGCGTGAGGCCAAATTGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 797 |
| LEAP-Seq percent confirming: | 99.0721 |
| LEAP-Seq n confirming: | 5018 |
| LEAP-Seq n nonconfirming: | 47 |
| LEAP-Seq n unique pos: | 52 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCTTCACCTTTTGCTGA |
| Suggested primer 2: | ACGTTGGACAGAGTCAACCC |