| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.233975 |
| Chromosome: | chromosome 1 |
| Location: | 6733835 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g048400 | DZIP1L,DZP1 | DAZ interacting zinc finger protein 1; (1 of 1) K16470 - zinc finger protein DZIP1 (DZIP1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAAGGGCTGGTGCACACATTCGGCTCGCA |
| Internal bar code: | TGCCCGCCGACACCGGGTGGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 608 |
| LEAP-Seq percent confirming: | 99.0838 |
| LEAP-Seq n confirming: | 4975 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 63 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGAACATGAAGATGAGCAA |
| Suggested primer 2: | GAATGTGAGCATGGTGAACG |