Insertion junction: LMJ.RY0402.234025_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.234025
Chromosome:chromosome_6
Location:1736245
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre06.g261750 sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):AGGTCAGCTGTGCATTCCCCTGGAGAGAAG
Internal bar code:GGGAAAAGGAGCTTAGTCAAAC

Confirmation - LEAP-Seq

LEAP-Seq distance:435
LEAP-Seq percent confirming:92.757
LEAP-Seq n confirming:397
LEAP-Seq n nonconfirming:31
LEAP-Seq n unique pos:17

Suggested primers for confirmation by PCR

Suggested primer 1:TCCTCCAAGCTGACCAAGAT
Suggested primer 2:GGTCAGGCATCAGGTACGTT