| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.234136 |
| Chromosome: | chromosome 1 |
| Location: | 4309320 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g029100 | (1 of 1) K10733 - GINS complex subunit 2 (GINS2, PSF2) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAACAATAACCAGGAATGAATGCATCCA |
| Internal bar code: | CCCGCGGGAGGTCGGCCAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 642 |
| LEAP-Seq percent confirming: | 96.3694 |
| LEAP-Seq n confirming: | 4539 |
| LEAP-Seq n nonconfirming: | 171 |
| LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTATCGAGGAGCTGGATG |
| Suggested primer 2: | CGTCAAGCTCAACAACCTCA |