| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.234143 |
| Chromosome: | chromosome 6 |
| Location: | 5273490 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g282651 | TRX16,TRL2 | (1 of 12) 1.6.5.4 - Monodehydroascorbate reductase (NADH); Thioredoxin-like protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAATCACATGCACTCGTCACCCAGCAGG |
| Internal bar code: | GTGAGGGCTTAGGACAACCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 696 |
| LEAP-Seq percent confirming: | 99.4447 |
| LEAP-Seq n confirming: | 2149 |
| LEAP-Seq n nonconfirming: | 12 |
| LEAP-Seq n unique pos: | 30 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCGGTTCTGGTGGAGAATG |
| Suggested primer 2: | CGGCTGAAGCTAGATGTTCC |