| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.234242 |
| Chromosome: | chromosome 9 |
| Location: | 6551996 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407950 | (1 of 2) IPR004911//IPR012336 - Gamma interferon inducible lysosomal thiol reductase GILT // Thioredoxin-like fold | 5'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCGGAGTGGTACCCGCGTGGGCCTACT |
| Internal bar code: | TCTGTGTGCGTCCCTCGTCCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1129 |
| LEAP-Seq percent confirming: | 98.6625 |
| LEAP-Seq n confirming: | 14901 |
| LEAP-Seq n nonconfirming: | 202 |
| LEAP-Seq n unique pos: | 21 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGCATAGTGCAAACCCACC |
| Suggested primer 2: | ACGGTTACTATGGTGCGGAG |