| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.234295 |
| Chromosome: | chromosome 2 |
| Location: | 966167 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g080050 | (1 of 2) PF00645 - Poly(ADP-ribose) polymerase and DNA-Ligase Zn-finger region (zf-PARP) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCCTATGGGCCCTCAAAGGCGAGGGTCG |
| Internal bar code: | GACCCGCGTGTTAATTGGCCAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 709 |
| LEAP-Seq percent confirming: | 88.8734 |
| LEAP-Seq n confirming: | 2548 |
| LEAP-Seq n nonconfirming: | 319 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TATGGCACGGTAACACCTGA |
| Suggested primer 2: | AAATACAGGACGACGCCAAC |