| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.234300 |
| Chromosome: | chromosome 13 |
| Location: | 5068265 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g607100 | CYG6 | (1 of 22) PTHR11017//PTHR11017:SF145 - LEUCINE-RICH REPEAT-CONTAINING PROTEIN // SUBFAMILY NOT NAMED; Adenylate/guanylate cyclase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGGCGGATGTGGGTGTGGTGCGCGTGG |
| Internal bar code: | GGCGCGCCCGCTTGGAGCGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 132 |
| LEAP-Seq percent confirming: | 59.2119 |
| LEAP-Seq n confirming: | 1713 |
| LEAP-Seq n nonconfirming: | 1180 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAAGCAACCCGCTCTCTAC |
| Suggested primer 2: | AACTGGATGGACTGGTGAGC |