| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.234328 |
| Chromosome: | chromosome 6 |
| Location: | 5076857 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g280550 | (1 of 1) K13107 - RNA-binding motif protein, X-linked 2 (RBMX2, IST3) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCGTGCTGCCTTTGCGTTGTATGCAGGC |
| Internal bar code: | TAAGGGCTCCAACCGGACTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 227 |
| LEAP-Seq percent confirming: | 94.4444 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGAAACTAGAAATCAGCGCC |
| Suggested primer 2: | CCTCCTTAATCTTGGGCTCC |