| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.234337 |
| Chromosome: | chromosome 3 |
| Location: | 5379779 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g184550 | LPA3,CPLD28 | (1 of 1) PTHR34051:SF2 - PROTEIN LOW PSII ACCUMULATION 3, CHLOROPLASTIC; Low Photosystem II Accumulation 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCACACCCATGCGCCCGCCTTGTCTGCACG |
| Internal bar code: | GATGGCGTCGGCGTGGACGGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 321 |
| LEAP-Seq percent confirming: | 79.1532 |
| LEAP-Seq n confirming: | 16376 |
| LEAP-Seq n nonconfirming: | 4313 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGTGCGCGTACTAGTGGAA |
| Suggested primer 2: | TGTTACAGGGGGTAAGGCAG |