Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.234483 |
Chromosome: | chromosome 2 |
Location: | 3109443 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g095058 | (1 of 274) IPR020683 - Ankyrin repeat-containing domain | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGATGAACAAGCCTTCGAATTGGCGAAATG |
Internal bar code: | ACTTGCGCCCCGCGGCCCATAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 764 |
LEAP-Seq percent confirming: | 90.2472 |
LEAP-Seq n confirming: | 4673 |
LEAP-Seq n nonconfirming: | 505 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAACAGTGGCCAGGTGAAAT |
Suggested primer 2: | TTGAGCCACTTCACAGAACG |