Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.234554 |
Chromosome: | chromosome 17 |
Location: | 62011 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g696600 | FMR1 | (1 of 1) PTHR11632:SF6 - PROTEIN F48E8.3; Fumarate reductase 1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGGGCGGGTACAGGGTTAGGCGGGTTCAG |
Internal bar code: | TGTACCGTCTCAGTTTCAAATC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 218 |
LEAP-Seq percent confirming: | 99.2928 |
LEAP-Seq n confirming: | 14040 |
LEAP-Seq n nonconfirming: | 100 |
LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGGGGTAGTTGGCGAGATT |
Suggested primer 2: | AGCAATGTGTTGAGTTTGCG |