| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.234619 |
| Chromosome: | chromosome 13 |
| Location: | 3484914 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g587750 | COG6 | Component of oligomeric golgi complex; (1 of 1) PF06419 - Conserved oligomeric complex COG6 (COG6) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGTGTCAACGCCAACTTGCACATGCACA |
| Internal bar code: | TTGTTTCCTGCGCCCGCTAGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 715 |
| LEAP-Seq percent confirming: | 99.2683 |
| LEAP-Seq n confirming: | 10040 |
| LEAP-Seq n nonconfirming: | 74 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACACACACACACACCG |
| Suggested primer 2: | GAGCAGAGGGTGGTGAGAAG |