| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.234626 |
| Chromosome: | chromosome 12 |
| Location: | 4370031 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g520350 | ALDH12A1,ALD1,ALDH12 | (1 of 1) 1.2.1.88 - L-glutamate gamma-semialdehyde dehydrogenase / Pyrroline-5-carboxylate dehydrogenase; Aldehyde dehydrogenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGTACACAGCAGGTAAATCCACGAGTAC |
| Internal bar code: | AATAATCGTGCCAGGGCTCGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 701 |
| LEAP-Seq percent confirming: | 97.689 |
| LEAP-Seq n confirming: | 4354 |
| LEAP-Seq n nonconfirming: | 103 |
| LEAP-Seq n unique pos: | 72 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTACTACCTCCATCACCGCC |
| Suggested primer 2: | CCGTTGCAAAATTGAATGTG |