| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.234630 |
| Chromosome: | chromosome 10 |
| Location: | 5054507 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g455750 | SRH19 | (1 of 3) K15710 - E3 ubiquitin-protein ligase SHPRH [EC:3.6.4.- 6.3.2.19] (SHPRH); SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCCTGTGTTTGTGCCTGTACGACACGTCA |
| Internal bar code: | CACGCACCCGCGTTTCCATGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 709 |
| LEAP-Seq percent confirming: | 93.7991 |
| LEAP-Seq n confirming: | 27833 |
| LEAP-Seq n nonconfirming: | 1840 |
| LEAP-Seq n unique pos: | 222 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGAAGGAGGAGGAGGAGGA |
| Suggested primer 2: | CTTTGTTCCCCTGCATTCTC |