| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.234653 |
| Chromosome: | chromosome 17 |
| Location: | 2074409 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g712050 | (1 of 8) PF01697 - Glycosyltransferase family 92 (Glyco_transf_92) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACCAAAATGCCGCCGTACGGCTCAAAT |
| Internal bar code: | GACTATACATACATGAGGTCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 864 |
| LEAP-Seq percent confirming: | 98.7867 |
| LEAP-Seq n confirming: | 3501 |
| LEAP-Seq n nonconfirming: | 43 |
| LEAP-Seq n unique pos: | 66 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTGCAACATACCACACGTC |
| Suggested primer 2: | GAGCACCTTTACATTCGGGA |