| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.234668 |
| Chromosome: | chromosome 4 |
| Location: | 1734653 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g212400 | UBC15 | (1 of 10) IPR001876 - Zinc finger, RanBP2-type | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCTAGGAGACACACAGCACGGTCCGGTAGT |
| Internal bar code: | CAAAAGGGCGACCGGCATACAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 197 |
| LEAP-Seq percent confirming: | 33.7719 |
| LEAP-Seq n confirming: | 924 |
| LEAP-Seq n nonconfirming: | 1812 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCAACTCCAACAACGACA |
| Suggested primer 2: | TGGTTTGGTTTCAATGCTGA |