| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.235029 |
| Chromosome: | chromosome 3 |
| Location: | 2913691 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g162950 | CCDC81 | Coiled coil domain containing protein 81; (1 of 1) PTHR14362:SF2 - COILED-COIL DOMAIN-CONTAINING PROTEIN 81 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGCTCCCACTCCAGCCGCCGCTCCAGCT |
| Internal bar code: | CCATGCGGCTACGAGCTCTTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 640 |
| LEAP-Seq percent confirming: | 76.0979 |
| LEAP-Seq n confirming: | 1958 |
| LEAP-Seq n nonconfirming: | 615 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTTGCGAAGATGCCTACTC |
| Suggested primer 2: | CCTAGCTGAACCTGACTGGC |