| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.235076 |
| Chromosome: | chromosome 17 |
| Location: | 5813040 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g739550 | CPLD12 | Conserved in the Plant Lineage and Diatoms; (1 of 11) 2.7.4.3 - Adenylate kinase / Myokinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGCAGGGGGTGCCGGGTTGAGAGGGC |
| Internal bar code: | AGATTTCCGCGTTTATAGAAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1083 |
| LEAP-Seq percent confirming: | 99.34 |
| LEAP-Seq n confirming: | 25586 |
| LEAP-Seq n nonconfirming: | 170 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAGCCAGGTGCAGACTGATG |
| Suggested primer 2: | CTTCCTTTCGTGCTGACTCC |