Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.235149 |
Chromosome: | chromosome 3 |
Location: | 4991271 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g180250 | IPS1,INO1 | (1 of 1) 5.5.1.4 - Inositol-3-phosphate synthase / Myo-inositol-1-phosphate synthase; Myo-inositol-1-phosphate synthase | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCGCCGGCTAGCGTGAAGGAAGTGAAC |
Internal bar code: | AATTCGGTAAGCTGGCGTGTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 720 |
LEAP-Seq percent confirming: | 99.8343 |
LEAP-Seq n confirming: | 1205 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTACCACAGCCCCAGACCTA |
Suggested primer 2: | CTGGTCATCCACAACACCTG |