Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.235162 |
Chromosome: | chromosome 12 |
Location: | 8158349 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g551050 | (1 of 1) PTHR31802//PTHR31802:SF3 - FAMILY NOT NAMED // 32 KDA HEAT SHOCK PROTEIN | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTTGCGGTTGCACGCAGCCGAGAACCAGG |
Internal bar code: | ATAGACAATCGGCGCGAGGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 345 |
LEAP-Seq percent confirming: | 90.9507 |
LEAP-Seq n confirming: | 1588 |
LEAP-Seq n nonconfirming: | 158 |
LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGTTGAGGTGACACCCTT |
Suggested primer 2: | ACACACACACACACACACGC |