Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.235212 |
Chromosome: | chromosome 3 |
Location: | 2440332 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g159254 | AMT1,AMT1A | (1 of 1) IPR001905//IPR024041//IPR029020 - Ammonium transporter // Ammonium transporter AmtB-like domain // Ammonium/urea transporter; Ammonium Transporter | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGAACCAGCCGAACCACAACAGGAAGGTG |
Internal bar code: | TCATTCTAGTCCCATCTATGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1219 |
LEAP-Seq percent confirming: | 99.2093 |
LEAP-Seq n confirming: | 11042 |
LEAP-Seq n nonconfirming: | 88 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACGGAGCGATTTCTCGTAG |
Suggested primer 2: | CACGCACCTTCAGCTTGTAA |