| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.235238 |
| Chromosome: | chromosome 3 |
| Location: | 3034519 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g164050 | KIN15-1,KIN15A,KIN12-1 | Kinesin motor protein; (1 of 2) K10400 - kinesin family member 15 (KIF15) | intron|outside_mRNA |
| Cre03.g164101 | LSM7 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACATCCGCCTGTCGCCATACACAACGGCC |
| Internal bar code: | GGCACGAGAACGTGGATCGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 488 |
| LEAP-Seq percent confirming: | 99.189 |
| LEAP-Seq n confirming: | 3180 |
| LEAP-Seq n nonconfirming: | 26 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCTCTTAATGTGGCTGTGC |
| Suggested primer 2: | GTCTAGCAGGTGGTGGTGGT |