| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.235330 |
| Chromosome: | chromosome 1 |
| Location: | 4361162 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g029500 | CDPKK3 | Calcium/calmodulin-dependent protein kinase kinase; (1 of 1) PTHR24347//PTHR24347:SF249 - SERINE/THREONINE-PROTEIN KINASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGCCACTACAAGCATTGCATGACCCTGTT |
| Internal bar code: | CTTGTTTCGCTACGTGGAACAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 372 |
| LEAP-Seq percent confirming: | 99.6833 |
| LEAP-Seq n confirming: | 5980 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAGGCGTTACAAGAGTGT |
| Suggested primer 2: | GTACGGGCATGTACGGCTAC |