| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.235387 |
| Chromosome: | chromosome 1 |
| Location: | 2064712 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g011100 | CAS1 | (1 of 1) 5.4.99.8 - Cycloartenol synthase / 2,3-epoxysqualene--cycloartenol cyclase; Terpenoid cylase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGATGTGCGCGTGCAGTTTCGGATTGGCT |
| Internal bar code: | CATAGGTCCGGCCCAATTCGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 607 |
| LEAP-Seq percent confirming: | 99.3303 |
| LEAP-Seq n confirming: | 2818 |
| LEAP-Seq n nonconfirming: | 19 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTCCTCCTTCATCCCTTCC |
| Suggested primer 2: | GGTATCGGCAGGTCACAGTT |