| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.235388 |
| Chromosome: | chromosome 1 |
| Location: | 5557297 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g039500 | FAP89 | Flagellar Associated Protein 89; (1 of 3) PTHR22847:SF361 - JOUBERIN | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGTATGAACGCGCCAGGCAGCCAACGACG |
| Internal bar code: | GAGTCCCGGACGTGTTCGACGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1145 |
| LEAP-Seq percent confirming: | 98.2255 |
| LEAP-Seq n confirming: | 11292 |
| LEAP-Seq n nonconfirming: | 204 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGTCACGGTACCAATCAGGC |
| Suggested primer 2: | GGTCACATGAACCTTCCGTT |