| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.235506 |
| Chromosome: | chromosome 14 |
| Location: | 219861 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g609202 | Conserved Protein With Tyrosinase Domain; (1 of 1) 3.4.24.7 - Interstitial collagenase / Vertebrate collagenase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCTCCACAACTGGCTCCCCCCTCCTCCAA |
| Internal bar code: | TGGCTGTGACCAGGCACGATTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 645 |
| LEAP-Seq percent confirming: | 77.67 |
| LEAP-Seq n confirming: | 8727 |
| LEAP-Seq n nonconfirming: | 2509 |
| LEAP-Seq n unique pos: | 67 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAACCAGTCCACAACTCCG |
| Suggested primer 2: | ACTTCCACACGCAGGGTATC |