| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.235526 |
| Chromosome: | chromosome 7 |
| Location: | 168099 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g313302 | (1 of 1) K03027 - DNA-directed RNA polymerases I and III subunit RPAC1 (RPC40, POLR1C) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAACCTCCCCAGGTGTGCGCCTGTACCC |
| Internal bar code: | GCTGCTCTCATGTTCGCTCGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 810 |
| LEAP-Seq percent confirming: | 95.2855 |
| LEAP-Seq n confirming: | 18170 |
| LEAP-Seq n nonconfirming: | 899 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGGTGTTTTCGTCTCCATA |
| Suggested primer 2: | CTCGCTCACTCACCAACGTA |