| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.235594 |
| Chromosome: | chromosome 12 |
| Location: | 5267515 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g528500 | MTH1,NUDT1 | (1 of 1) 3.6.1.56 - 2-hydroxy-dATP diphosphatase / Oxidized purine nucleoside triphosphatase; Oxidized purine nucleoside triphosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGAGGTGCACGGTGAGCCTGGGTAGTTG |
| Internal bar code: | ACATTCCCATCCCCCGATCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 716 |
| LEAP-Seq percent confirming: | 93.6735 |
| LEAP-Seq n confirming: | 5049 |
| LEAP-Seq n nonconfirming: | 341 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACATTTTGTCGAAAGGCACC |
| Suggested primer 2: | CACGGGTACTACTGGGGAGA |