Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.235594 |
Chromosome: | chromosome 12 |
Location: | 5267518 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g528500 | MTH1,NUDT1 | (1 of 1) 3.6.1.56 - 2-hydroxy-dATP diphosphatase / Oxidized purine nucleoside triphosphatase; Oxidized purine nucleoside triphosphatase | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCGGGTTGTCATCGAACGTGAACACCAG |
Internal bar code: | CGCGGCTTCCTACATACGCAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 700 |
LEAP-Seq percent confirming: | 99.0482 |
LEAP-Seq n confirming: | 1665 |
LEAP-Seq n nonconfirming: | 16 |
LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACATTTTGTCGAAAGGCACC |
Suggested primer 2: | CACGGGTACTACTGGGGAGA |